Government of New York
WARNING: Use of a Virtual Private Network (VPN), proxy, or internet anonymizer service will cause problems with your ability to apply or certify for benefits. Turn these services off before accessing online services. If you cannot turn off your VPN please call 1-888-209-8124 to apply for benefits or 1-888-581-5812 to certify for benefits.
Get a quote
Apple Card
Sign in to view your Apple Card balances, Apple Card Monthly Installments, make payments, and download your monthly statements.
Get a quote
Petanns
A text message with a 4-digit verification code was just sent to •••• •••• Need an account? Register. Submit
Get a quote
Petanns
A text message with a 4-digit verification code was just sent to •••• •••• Need an account? Register. Submit
Get a quote
Services Hub
The Services Hub helps customers stay connected and be proactive by providing visibility into their Microsoft products and services, training and support resources customized for them, and solution monitoring to help prevent and resolve issues faster.
Get a quote
ASA
ASA. Log in, or Create an Account. Forgot your password? Not a member? Join Now. For further assistance, email Member Services, or call 630-912-2552 between 7:30am and 4:30pm (CT).
Get a quote
Aston Martin Configurator
Build and configure your new DBX, Vantage, DB11 and DBS with the Aston Martin car configurator.
Get a quote
Login
Email or User ID. Password Forgot password? Remember Email or User ID. Login. Become part of HealthTrust Member Registration | Supplier Registration. Member Support: P: 888.222.1172 | [email protected] Hours: 7 a.m. to 5 p.m. CST, Monday - Friday
Get a quote
Inspira
Clear your browser cookies and cache before you login to inspira. Click here for instructions
Get a quote
.ncbi.nlm.nih.gov
>m90846.1 salmonella typhimurium inva (inva) gene, complete cds gatattgcctacaagcatgaaatggcagaacagcgtcgtactattgaaaagctgtcttaatttaatatta
Get a quote
Government of New York
WARNING: Use of a Virtual Private Network (VPN), proxy, or internet anonymizer service will cause problems with your ability to apply or certify for benefits. Turn these services off before accessing online services. If you cannot turn off your VPN please call 1-888-209-8124 to apply for benefits or 1-888-581-5812 to certify for benefits.
Get a quote
Inspira
Clear your browser cookies and cache before you login to inspira. Click here for instructions
Get a quote
ASA
ASA. Log in, or Create an Account. Forgot your password? Not a member? Join Now. For further assistance, email Member Services, or call 630-912-2552 between 7:30am and 4:30pm (CT).
Get a quote.ncbi.nlm.nih.gov
>m90846.1 salmonella typhimurium inva (inva) gene, complete cds gatattgcctacaagcatgaaatggcagaacagcgtcgtactattgaaaagctgtcttaatttaatatta
Get a quote
Login
Email or User ID. Password Forgot password? Remember Email or User ID. Login. Become part of HealthTrust Member Registration | Supplier Registration. Member Support: P: 888.222.1172 | [email protected] Hours: 7 a.m. to 5 p.m. CST, Monday - Friday
Get a quote